NIID NOTCH2NLC

Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6

Inheritance

Autosomal dominant

Description

Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss¹. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.

Prevalence

>400 patients reported in literature². Found in individuals of East Asian ancestry³.

Age of Onset Details

Typical: 30-70⁴; Range: 10⁵- 78⁶.

Locus

hg19

chr1:145209323-145209354

hg38

chr1:149390802-149390842

t2t

chr1:148519695-148519738

Details

Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats⁷. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype^8,9: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders¹⁰. Age of onset inversely related to allele size¹¹. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype¹². Interruptions documented: GGA, GGG¹³; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed¹⁴. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.

Mechanism

GoF

Polyglycine expansion; may relate to methylation or RNA pathogenicity^4,15,14. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy¹⁶. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported¹⁷.

Year

2019¹⁸

Location in Gene

5' UTR

Gene Strand

Alleles

Ref. Motif

GGC

Pathogenic (ref.)

GGC

Pathogenic (gene)

CGG

gnomAD

Pathogenic genotype frequency data is not displayed for this locus because a substantial number of large alleles failed manual review by the gnomAD team.

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0011327

Heterogenous Genetic, Clinical, and Imaging Features in Patients with Neuronal Intranuclear Inclusion Disease Carrying

Yusran Ady,Fitrah, Yo,Higuchi, Norikazu,Hara, Takayoshi,Tokutake, Masato,Kanazawa, Kazuhiro,Sanpei, Tomone,Taneda, Akihiko,Nakajima, Shin,Koide, Shintaro,Tsuboguchi, Midori,Watanabe, Junki,Fukumoto, Shoichiro,Ando, Tomoe,Sato, Yohei,Iwafuchi, Aki,Sato, Hideki,Hayashi, Takanobu,Ishiguro, Hayato,Takeda, Toshiaki,Takahashi, Nobuyoshi,Fukuhara, Kensaku,Kasuga, Akinori,Miyashita, Osamu,Onodera, Takeshi,Ikeuchi

Brain sciences · 2023-06-15

pmid:37371433

Neurological disorders caused by novel non-coding repeat expansions: clinical features and differential diagnosis.

Elisa,Vegezzi, Hiroyuki,Ishiura, D Cristopher,Bragg, David,Pellerin, Francesca,Magrinelli, Riccardo,Currò, Stefano,Facchini, Arianna,Tucci, John,Hardy, Nutan,Sharma, Matt C,Danzi, Stephan,Zuchner, Bernard,Brais, Mary M,Reilly, Shoji,Tsuji, Henry,Houlden, Andrea,Cortese

The Lancet. Neurology · 2024-07-01

pmid:38876750

omim:603472

Clinical Features and Classification of Neuronal Intranuclear Inclusion Disease.

Hongfei,Tai, An,Wang, Yumei,Zhang, Shaocheng,Liu, Yunzhu,Pan, Kai,Li, Guixian,Zhao, Mengwen,Wang, Guode,Wu, Songtao,Niu, Hua,Pan, Bin,Chen, Wei,Li, Xingao,Wang, Gehong,Dong, Wei,Li, Ying,Zhang, Sheng,Guo, Xiaoyun,Liu, Mingxia,Li, Hui,Liang, Ming,Huang, Wei'an,Chen, Zaiqiang,Zhang

Neurology. Genetics · 2023-02-28

pmid:37090934

Rapidly progressive adult-onset neuronal intranuclear inclusion disease beginning with autonomic symptoms: a case report.

Yi,Zhu, Qian,Yang, Yun,Tian, Weibing,Fan, Xinfa,Mao

Frontiers in neurology · 2023-05-25

pmid:37305750

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

Erratum: Prevalence and Characterization of

Neurology. Genetics · 2024-07-12

pmid:39055960

Familial adult-onset neuronal intranuclear inclusion disease: A case report and literature review.

Lijun,Wei, Jiaqi,Wang, Changming,Xu, Tengchao,Yang, Yun,Tian, Lu,Shen

Medicine · 2024-11-01

pmid:39496005

Expansion of Human-Specific GGC Repeat in Neuronal Intranuclear Inclusion Disease-Related Disorders.

Yun,Tian, Jun-Ling,Wang, Wen,Huang, Sheng,Zeng, Bin,Jiao, Zhen,Liu, Zhao,Chen, Yujing,Li, Ying,Wang, Hao-Xuan,Min, Xue-Jing,Wang, Yong,You, Ru-Xu,Zhang, Xiao-Yu,Chen, Fang,Yi, Ya-Fang,Zhou, Hong-Yu,Long, Chao-Jun,Zhou, Xuan,Hou, Jun-Pu,Wang, Bin,Xie, Fan,Liang, Zhuan-Yi,Yang, Qi-Ying,Sun, Emily G,Allen, Andrew Mark,Shafik, Ha Eun,Kong, Ji-Feng,Guo, Xin-Xiang,Yan, Zheng-Mao,Hu, Kun,Xia, Hong,Jiang, Hong-Wei,Xu, Ran-Hui,Duan, Peng,Jin, Bei-Sha,Tang, Lu,Shen

American journal of human genetics · 2019-06-06

pmid:31178126

Neuronal Intranuclear Inclusion Disease with NOTCH2NLC GGC Repeat Expansion: A Systematic Review and Challenges of Phenotypic Characterization.

Tian,Zeng, Yiqun,Chen, Honghao,Huang, Shengqi,Li, Jiaqi,Huang, Haobo,Xie, Shenyi,Lin, Siyao,Chen, Guangyong,Chen, Dehao,Yang

Aging and disease · 2024-02-16

pmid:38377026

The Phenotypes and Mechanisms of NOTCH2NLC-Related GGC Repeat Expansion Disorders: a Comprehensive Review.

Xiu-Rong,Huang, Bei-Sha,Tang, Peng,Jin, Ji-Feng,Guo

Molecular neurobiology · 2021-10-31

pmid:34718964

Comprehensive genetic diagnosis of tandem repeat expansion disorders with programmable targeted nanopore sequencing.

Igor,Stevanovski, Sanjog R,Chintalaphani, Hasindu,Gamaarachchi, James M,Ferguson, Sandy S,Pineda, Carolin K,Scriba, Michel,Tchan, Victor,Fung, Karl,Ng, Andrea,Cortese, Henry,Houlden, Carol,Dobson-Stone, Lauren,Fitzpatrick, Glenda,Halliday, Gianina,Ravenscroft, Mark R,Davis, Nigel G,Laing, Avi,Fellner, Marina,Kennerson, Kishore R,Kumar, Ira W,Deveson

Science advances · 2022-03-04

pmid:35245110

Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.

Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman

Nature reviews. Genetics · 2024-03-11

pmid:38467784

Clinical and neuroimaging review of triplet repeat diseases.

Ryo,Kurokawa, Mariko,Kurokawa, Akihiko,Mitsutake, Moto,Nakaya, Akira,Baba, Yasuhiro,Nakata, Toshio,Moritani, Osamu,Abe

Japanese journal of radiology · 2022-09-28

pmid:36169768

uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease

Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong

Cell Communication and Signaling · 2025-02-07

doi:10.1186/s12964-025-02079-1

Plasma p-tau species are elevated in presymptomatic and symptomatic neuronal intranuclear inclusion disease.

Sizhe,Zhang, Bin,Jiao, Yan,Zeng, Qiying,Sun, Xiaoyu,Chen, Weiwei,Zhang, Ziyu,Ouyang, Qiao,Xiao, Lu,Zhou, Yunni,Li, Ling,Weng, Juan,Du, Qian,Xu, Yang,Yang, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hongyu,Long, Yuanyuan,Xie, Si,Chen, Li,Feng, Qing,Huang, Lili,Long, Yafang,Zhou, Fang,Yi, Yacen,Hu, Qiong,Liu, Yongcheng,Pan, Lin,Zhou, Yulai,Li, Shuo,Hu, Jifeng,Guo, Junling,Wang, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Yun,Tian, Lu,Shen

EBioMedicine · 2026-01-14

pmid:41539185

Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease.

Hiroyuki,Ishiura, Shota,Shibata, Jun,Yoshimura, Yuta,Suzuki, Wei,Qu, Koichiro,Doi, M Asem,Almansour, Junko Kanda,Kikuchi, Makiko,Taira, Jun,Mitsui, Yuji,Takahashi, Yaeko,Ichikawa, Tatsuo,Mano, Atsushi,Iwata, Yasuo,Harigaya, Miho Kawabe,Matsukawa, Takashi,Matsukawa, Masaki,Tanaka, Yuichiro,Shirota, Ryo,Ohtomo, Hisatomo,Kowa, Hidetoshi,Date, Aki,Mitsue, Hiroyuki,Hatsuta, Satoru,Morimoto, Shigeo,Murayama, Yasushi,Shiio, Yuko,Saito, Akihiko,Mitsutake, Mizuho,Kawai, Takuya,Sasaki, Yusuke,Sugiyama, Masashi,Hamada, Gaku,Ohtomo, Yasuo,Terao, Yoshihiko,Nakazato, Akitoshi,Takeda, Yoshio,Sakiyama, Yumi,Umeda-Kameyama, Jun,Shinmi, Katsuhisa,Ogata, Yutaka,Kohno, Shen-Yang,Lim, Ai Huey,Tan, Jun,Shimizu, Jun,Goto, Ichizo,Nishino, Tatsushi,Toda, Shinichi,Morishita, Shoji,Tsuji

Nature genetics · 2019-07-22

pmid:31332380

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Pathogenic CGG expansions in oculopharyngodistal myopathy exhibit distinct characteristics of each causative gene on the flanking sequences as well as methylation status.

Nobuyuki,Eura, Satoru,Noguchi, Megumu,Ogawa, Kyuto,Sonehara, Ai,Yamanaka, Takashi,Kurashige, Shinichiro,Hayashi, Yukinori,Okada, Kazuma,Sugie, Ichizo,Nishino

Genome medicine · 2026-03-27

pmid:41888971

Clinical and imaging characteristics of NOTCH3-negative CADASIL-suspected patients with NOTCH2NLC GGC repeat expansions.

Hiraku,Matsuura, Daiki,Fukunaga, Ikuko,Mizuta, Chisato,Tamai, Rei,Yasuda, Mao,Mukai, Akiko,Watanabe-Hosomi, Takashi,Koizumi, Tomokatsu,Yoshida, Tomoyuki,Ohara, Takashi,Kasai, Jun,Sone, Toshiki,Mizuno

Journal of human genetics · 2026-03-26

pmid:41882342

Neuronal intranuclear inclusion disease caused by NOTCH2NLC gene expansion: a case report and literature review.

Linsen,Ye, Yue,Xu, Shuqing,Meng, Genshan,Gao, Yao,Liu, Boyuan,Ding, Nannuan,Liu

BMC neurology · 2026-03-20

pmid:41862851

Translation of expanded CGG repeats in LRP12 associated oculopharyngodistal myopathy.

Chengcheng,Li, Jil A,Daw, Sara K,Pittman, Connor J,Maltby, Hidetoshi,Sakurai, Peter K,Todd, Conrad C,Weihl

Acta neuropathologica communications · 2026-03-06

pmid:41792844

Short tandem repeat expansions in patients with neurodegenerative dementia.

Yuan,Zhu, Xuewen,Xiao, Yiliang,Liu, Zheng,Wang, Tengfei,Luo, Tianyan,Xu, Qijie,Yang, Xiaoli,Hao, Cong,Zhang, Sizhe,Zhang, Shilin,Luo, Yafang,Zhou, Xinxin,Liao, Yun,Tian, Ling,Weng, Liangjuan,Fang, Beisha,Tang, Bin,Jiao, Jinchen,Li, Lu,Shen

EBioMedicine · 2026-02-26

pmid:41762523

Recurrent migraine with visual aura as the primary phenotype of familial neuronal intranuclear inclusion disease.

Qingxiang,Zhang, Min,Gao, Yueshan,Piao, Sufen,Huang, Haitian,Nan, Zhen,Wang, Junjie,Li

Frontiers in neurology · 2026-02-11

pmid:41756172

NOTCH2NLC GGC repeat expansions cause retinal neurodegeneration in neuronal intranuclear inclusion disease mouse model.

Haibo,Li, Ying,Jiang, Lusi,Zhang, Xinhui,Wang, Yun,Tian, Qiying,Sun, Lu,Shen, Hong,Jiang, Beisha,Tang, Zhengmao,Hu, Yongcheng,Pan, Qiong,Liu

Cell & bioscience · 2026-02-23

pmid:41731582

Neuronal intranuclear inclusion disease: a diagnostic pitfall for MELAS.

Xu,Liu, Zhe-Sheng,Zhang, Qing-Qing,Tao

BMC neurology · 2026-02-13

pmid:41688968

Levodopa intolerance as a potential clinical red flag for neuronal intranuclear inclusion disease (NIID) in atypical parkinsonism: a case report.

Peixi,Zang, Ying,Liu, Yunfei,Hao

BMC neurology · 2026-02-03

pmid:41634634